Sabiia Seb
PortuguêsEspañolEnglish
Embrapa
        Busca avançada

Botão Atualizar


Botão Atualizar

Ordenar por: RelevânciaAutorTítuloAnoImprime registros no formato resumido
Registros recuperados: 14
Primeira ... 1 ... Última
Imagem não selecionada

Imprime registro no formato completo
Alfa-amilase em frangos de corte: efeitos do balanço eletrolítico e do nível protéico da dieta R. Bras. Zootec.
Monteiro,Marcela Piedade; Moraes,George Henrique Kling de; Fanchiotti,Flavia Escapini; Oliveira,Maria Goreti de Almeida; Rodrigues,Ana Cláudia Peres; Albino,Luiz Fernando Teixeira; Guimarães,Valéria Monteze; Vieites,Flávio Medeiros.
Um experimento foi conduzido com pintos de corte macho para o estudo dos efeitos dos níveis de 20 e 23% de PB combinados com 0, 50, 100, 150, 200, 250 mEq/kg de balanço dietético eletrolítico (BDE) sobre a atividade da alfa-amilase pancreática de frangos de corte de 1 a 21 dias de idade. O delineamento utilizado foi o inteiramente casualizado. Dietas e água foram fornecidas ad libitum. Aos 1, 7, 14 e 21 dias, três aves de cada tratamento foram sacrificadas por deslocamento cervical para remoção do pâncreas, o qual foi removido, homogeneizado, congelado em nitrogênio líquido e liofilizado. Uma alíquota de cada amostra foi solubilizada em água deionizada e centrifugada a 7500 x g por 3 minutos a 4ºC, para determinação da atividade da alfa-amilase no...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Alfa-amilase; Balanço eletrolítico; Frangos; Pâncreas; Proteína dietética.
Ano: 2006 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1516-35982006000400018
Imagem não selecionada

Imprime registro no formato completo
Atividade amilolítica e qualidade fisiológica de sementes armazenadas de milho super doce tratadas com ácido giberélico Rev. bras. sementes
Aragão,Carlos Alberto; Dantas,Bárbara França; Alves,Elza; Cataneo,Ana Catarina; Cavariani,Cláudio; Nakagawa,João.
O uso de reguladores de crescimento na fase de germinação melhora o desempenho das plântulas, acelerando a velocidade de emergência e realçando o potencial das sementes de várias espécies, mesmo sob condições adversas. Este trabalho teve como objetivo avaliar a influência do ácido giberélico na atividade amilolítica e no vigor de sementes armazenadas de milho super doce. O experimento foi conduzido nos Laboratórios de Análise de Sementes do Departamento de Produção Vegetal/FCA e no Laboratório de Bioquímica de Plantas do Departamento de Química e Bioquímica/IB da Universidade Estadual Paulista (UNESP/Botucatu), entre os meses de julho e setembro de 2001, onde foram feitas as avaliações da qualidade fisiológica, através dos testes de germinação, vigor e...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Biorreguladores; Zea mays; Milho doce; Alfa-amilase.
Ano: 2003 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-31222003000100008
Imagem não selecionada

Imprime registro no formato completo
Crescimento de plântulas do milho 'Saracura' e atividade de alfa-amilase e invertases associados ao aumento da tolerância ao alagamento exercido pelo cálcio exógeno Bragantia
Fries,Daniela Deitos; Alves,José Donizeti; Delú Filho,Nelson; Magalhães,Paulo César; Goulart,Patrícia de Fátima Pereira; Magalhães,Marcelo Murad.
Objetivou-se avaliar o crescimento da plântula e o metabolismo de carboidratos associados ao aumento da tolerância à hipoxia exercido pela presença do cálcio no período de germinação e/ou alagamento de plântulas de milho com diferentes idades. O experimento foi desenvolvido na Universidade Federal de Lavras, MG, em 2002. Cariopses de milho da variedade 'Saracura' (BRS-4154) foram germinadas em água ou solução de CaCl2. Após dois e quatro dias, as plântulas foram submetidas ao alagamento em tubos de PVC com tampão (com ou sem CaCl2) por três dias, sendo então avaliadas a sobrevivência, massa seca e as características bioquímicas. O cálcio aumentou a sobrevivência ao alagamento de plântulas com quatro dias, entretanto, não influenciou naquelas com dois dias....
Tipo: Info:eu-repo/semantics/article Palavras-chave: Invertase; Alfa-amilase; Cálcio; Hipoxia.
Ano: 2007 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0006-87052007000100001
Imagem não selecionada

Imprime registro no formato completo
Determinação da energia metabolizável do farelo residual do milho com e sem enzima em dietas para frangos de corte Arq. Bras. Med. Vet. Zootec.
Valadares,C.G.; Santos,J.S.; Lüdke,M.C.M.M.; Lüdke,J.V.; Silva,J.C.N.S.; Pereira,P.S..
RESUMO O objetivo deste trabalho foi avaliar o valor nutricional e determinar a energia metabolizável do farelo residual de milho (FRM) sem e com o uso da enzima alfa- amilase. Foi realizado um experimento de metabolismo com 180 pintos machos Cobb com 14 dias, distribuídos em um delineamento inteiramente ao acaso, com seis tratamentos, cinco repetições e seis aves por parcela. As dietas experimentais foram: T1: ração referência (RR), T2: 60% T1 + 40% de FRM, T3: RR + enzima, T4: 60% T1 + 40% de FRM com adição de enzima, T5: RR com substituição de 100% do milho pelo FRM e T6: RR com substituição de 100% do milho pelo FRM com adição de enzima. A composição química do FRM foi: 88,33% de matéria seca (MS), 10,23% de proteína bruta (PB), 15,44% de extrato...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Alfa-amilase; Alimento alternativo; Aves; Energia; Metabolismo.
Ano: 2016 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0102-09352016000300748
Imagem não selecionada

Imprime registro no formato completo
Diferentes épocas de colheita, secagem e armazenamento na qualidade de grãos de trigo comum e duro Bragantia
Carneiro,Luciana Maria Terra Alves; Biagi,João Domingos; Freitas,José Guilherme de; Carneiro,Marcelo Cristiano; Felício,João Carlos.
O objetivo do trabalho foi verificar a influência da época de colheita, secagem e período de armazenamento na qualidade de grãos de trigo comum e duro. Os experimentos foram instalados no campo do Núcleo Experimental de Campinas, IAC, usando DOIS genótipos de trigo comum (Triticum aestivum L), um com dormência na espiga (IAC 24), colhido com 30,0%; 21,4% e 12,2% de água e um sem dormência na espiga (IAC 289), colhido com 35,0%; 23,4% e 12,5% de água; além deum genótipo de trigo duro (Triticum durum L.) sem dormência (IAC 1003), colhido com 31,6%; 22,2% e 11,7% de água. A secagem foi realizada a 40, 60 e 80 ºC e um fluxo de ar de 20 m³ min-1.m-2. Após a secagem, os grãos foram armazenados em embalagens de polietileno por um período de 0, 2, 4, 6 e 8 meses a...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Alfa-amilase; Triticum aestivum; Triticum durum.
Ano: 2005 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0006-87052005000100014
Imagem não selecionada

Imprime registro no formato completo
Efeito do teor de amido danificado na produção de biscoitos tipo semi-duros Ciênc. Tecnol. Aliment.
Gutkoski,Luiz Carlos; Pagnussatt,Fernanda Arnhold; Spier,Franciela; Pedó,Ivone.
O trabalho objetivou estudar a danificação do amido de farinha de trigo por moagem e o seu efeito na produção de biscoitos tipo semi-duros. Amostras de trigo dos cultivares BR 23, BRS Angico e Rubi, com características diferentes quanto à dureza foram moídas em moinho de rolos através de uma passagem pelo conjunto de quebra; quebra mais três reduções na umidade 16% e quebra mais três reduções na umidade 12%. Neste tratamento, a moagem foi complementada pelo emprego de moinho de bolas. Nas farinhas, foram realizadas análises físicas, químicas, reológicas e funcionais, utilizando delineamento casualizado em planejamento fatorial completo 3 x 3, totalizando nove tratamentos. Os resultados foram analisados estatisticamente e, nos modelos significativos, as...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Triticum aestivum L; Moagem; Farinha; Alfa-amilase.
Ano: 2007 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-20612007000100021
Imagem não selecionada

Imprime registro no formato completo
Efeitos de níveis de ácido L-glutâmico e de vitamina K da dieta sobre a atividade de alfa-amilase em frangos de corte R. Bras. Zootec.
Fanchiotti,Flavia Escapini; Moraes,George Henrique Kling de; Oliveira,Maria Goreti de Almeida; Albino,Luiz Fernando Teixeira; Rodrigues,Ana Cláudia Peres; Reis,Efraim Lázaro; Monteiro,Marcela Piedade.
Foram investigados os efeitos nutricionais de dois níveis de ácido L-glutâmico (L-Glu) combinados com quatro níveis de vitamina K (Vit K) sobre a atividade de alfa-amilase no quimo e pâncreas de aves de corte. Frangos de corte machos de um dia foram criados em baterias aquecidas e alimentados, à vontade, com dietas contendo todos L-aminoácidos essenciais, minerais e vitaminas (exceto Vit K) até os 14 dias de idade. O experimento foi realizado em esquema fatorial, em delineamento inteiramente casualizado 2x4, com quatro repetições de oito aves cada. A dieta básica foi suplementada com 6,25 e 12,5% de L-Glu combinados com 0,02; 0,2; 20,0 e 200,0 mg de Vit K/kg de ração. Efeitos significativos de L-Glu e Vit K foram observados no quimo. A atividade específica...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Alfa-amilase; L-glutâmico; Pintos de corte; Vitamina K.
Ano: 2005 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1516-35982005000200023
Imagem não selecionada

Imprime registro no formato completo
Enzimas amilolíticas de mandioquinha-salsa (Arracacia xanthorrhiza Bancroft.) Ciênc. Tecnol. Aliment.
Pires,Tatiana da Costa Raposo; Veiga,Erika Matos da; Finardi Filho,Flávio.
O objetivo do presente trabalho foi de caracterizar as enzimas amilolíticas de mandioquinha-salsa (Arracacia xanthorrhiza Bancroft.). Foram realizados ensaios mediante a determinação da atividade enzimática, variando-se as condições do meio, tais como temperatura, pH e concentração de cátions. Em gel de eletroforese foram detectadas três bandas protéicas com intensa atividade hidrolítica. As enzimas apresentaram pH ótimo de atividade em torno de 6,0 e mostraram-se mais sensíveis a valores de pH alcalino quando pré-incubadas a 50oC. A temperatura ótima de ativação enzimática foi de 50oC, enquanto aos 70oC, a atividade amilásica foi reduzida em 80%. Em temperaturas altas temperaturas (60 e 70oC), a inativação enzimática ocorreu após 60 e 25min de incubação,...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Mandioquinha; Batata-baroa; Arracacia xanthorriza; Alfa-amilase; Beta-amilase; Caracterização enzimática.
Ano: 2002 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-20612002000300014
Imagem não selecionada

Imprime registro no formato completo
Fibra de casca de laranja como substituto de gordura em pão de forma Ciência Rural
Stoll,Liana; Flôres,Simone Hickmann; Thys,Roberta Cruz Silveira.
Os subprodutos da indústria de frutas possuem alta qualidade nutricional, de forma que sua transformação em ingredientes para aplicação em produtos alimentícios é de grande importância. No presente estudo, foram avaliados os efeitos da substituição total da gordura em pães de forma através da utilização de fibra de casca de laranja (0 a 5%), um subproduto industrial. A adição da fibra de laranja foi combinada ao uso de α-amilase (10 a 50ppm), através de um planejamento experimental fatorial completo 22. Para fins de comparação, foi elaborada uma formulação controle, sem fibras, sem enzimas e com 2% de gordura. A qualidade dos pães foi avaliada através de análises de vida útil (por índice de retrogradação, DSC), volume, cor, atividade de água e análise...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Fibra da casca da laranja; Subproduto; Alfa-amilase; Vida útil; Índice de retrogradação.
Ano: 2015 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0103-84782015000300567
Imagem não selecionada

Imprime registro no formato completo
Niveis de alfa amilase de farinhas de algumas cultivares de trigos brasileiros. Infoteca-e
BELEIA, A..
Farinhas de algumas cultivares de trigo provenientes de Passo Fundo, RS e de Brasília, DF, foram comparadas quanto ao rendimento de moagem, teores de cinza e proteína, viscosidade máxima e conteúdo em alfa - amilase. A média do rendimento em farinhas para os trigos do sul, 71,8%, não foi estatisticamente diferente da media do rendimento para o trigo do cerrado, 74,2%. As médias para teores de proteína e cinza, das farinhas dos trigos do sul, foram 11, 66g/100g e 0,501g/100g, respectivamente. As médias para teores de proteína e cinza, das farinhas de trigo do cerrado, foram 12,59g/100g e 0,562g/100g, respectivamente. As médias da viscosidade máxima forma 435,4 U. A. e 577,3 U. A. para farinhas de trigo proveniente do sul e do cerrado, respectivamente. As...
Tipo: Boletim de Pesquisa e Desenvolvimento (INFOTECA-E) Palavras-chave: Qualidade tecnológica; Trigo; Farinhas; Cultivares; Alfa-amilase; Viscosidade máxima.
Ano: 1982 URL: http://www.infoteca.cnptia.embrapa.br/handle/doc/415631
Imagem não selecionada

Imprime registro no formato completo
Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho Rev. bras. sementes
Dantas,Bárbara França; Aragão,Carlos Alberto; Araújo-Junior,João Pessoa; Rodrigues,João Domingos; Cavariani,Cláudio; Nakagawa,João.
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina;...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Zea mays; Sementes; Alfa-amilase; RT-PCR.
Ano: 2002 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-31222002000200019
Imagem não selecionada

Imprime registro no formato completo
Rendimento e processo germinativo do grão na espiga de genótipos de trigo. Repositório Alice
FELICIO, J. C.; CAMARGO, C.E. de O.; GERMANI, R.; FREITAS, J.G. de.
O objetivo deste trabalho foi estudar o processo germinativo dos grãos na espiga, o rendimento de grãos, a adaptabilidade e a estabilidade em genótipos de trigo (Triticum aestivum L.) sensíveis às variações ambientais. Os experimentos foram instalados no Núcleo Experimental do Instituto Agronômico, em Campinas, SP, no período de 1996 a 1998. A germinação na espiga foi avaliada pelo método do "Falling Number", que consiste em determinar o nível de atividade da alfa-amilase nos grãos. A segunda e a terceira colheitas foram realizadas ao sete e quatorze dias após a primeira colheita. O atraso da colheita determinou redução no rendimento, notadamente na terceira colheita; os teores de alfa-amilase foram maiores também na terceira colheita, em virtude da...
Tipo: Artigo em periódico indexado (ALICE) Palavras-chave: Triticum aestivum; Germinabilidade; Alfa-amilase; Época de semeadura; Germinability; Alpha-amylase; Sowing date.
Ano: 2002 URL: http://www.alice.cnptia.embrapa.br/handle/doc/106780
Imagem não selecionada

Imprime registro no formato completo
Rendimento e processo germinativo do grão na espiga de genótipos de trigo PAB
Felicio,João Carlos; Camargo,Carlos Eduardo de Oliveira; Germani,Rogério; Freitas,José Guilherme de.
O objetivo deste trabalho foi estudar o processo germinativo dos grãos na espiga, o rendimento de grãos, a adaptabilidade e a estabilidade em genótipos de trigo (Triticum aestivum L.) sensíveis às variações ambientais. Os experimentos foram instalados no Núcleo Experimental do Instituto Agronômico, em Campinas, SP, no período de 1996 a 1998. A germinação na espiga foi avaliada pelo método do "Falling Number", que consiste em determinar o nível de atividade da alfa-amilase nos grãos. A segunda e a terceira colheitas foram realizadas ao sete e quatorze dias após a primeira colheita. O atraso da colheita determinou redução no rendimento, notadamente na terceira colheita; os teores de alfa-amilase foram maiores também na terceira colheita, em virtude da...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Triticum aestivum; Germinabilidade; Alfa-amilase; Época de semeadura.
Ano: 2002 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2002000300009
Imagem não selecionada

Imprime registro no formato completo
Uso de alfa-amilase em dietas, superestimando ou não a energia metabolizável do farelo de soja, no desempenho de frangos de corte. Infoteca-e
BRUM, P. A. R. de; LIMA, G. J. M. M. de; AVILA, V. S. de; COLDEBELLA, A.; ZANOTTO, D. L.; TOIGO, G. C..
2007
Tipo: Comunicado Técnico (INFOTECA-E) Palavras-chave: Alfa-amilase; Composição; Química; Energia; Metabolizável; Frango de corte.
Ano: 2007 URL: http://www.infoteca.cnptia.embrapa.br/handle/doc/962481
Registros recuperados: 14
Primeira ... 1 ... Última
 

Empresa Brasileira de Pesquisa Agropecuária - Embrapa
Todos os direitos reservados, conforme Lei n° 9.610
Política de Privacidade
Área restrita

Embrapa
Parque Estação Biológica - PqEB s/n°
Brasília, DF - Brasil - CEP 70770-901
Fone: (61) 3448-4433 - Fax: (61) 3448-4890 / 3448-4891 SAC: https://www.embrapa.br/fale-conosco

Valid HTML 4.01 Transitional