Sabiia Seb
PortuguêsEspañolEnglish
Embrapa
        Busca avançada

Botão Atualizar


Botão Atualizar

Registro completo
Provedor de dados:  Repositório Alice
País:  Brazil
Título:  Distribuição dos grupos de compatibilidade A1 e A2 de Phytophthora infestans nas regiões sul e sudeste do Brasil.
Autores:  ZANOTTA, S.
TOFOLI, J. G.
SALAS, F. J. S.
TERÇARIOL, I. M. L.
DOMINGUES, R. J.
FERRARI, J. T.
RIVAS, E. B.
PRADO, S. de S.
SILVA, G. A. C.
MARCIANO, C. S.
HARAKAVA, R.
Data:  2017-04-03
Ano:  2016
Palavras-chave:  Straminipila
Resumo:  A requeima, causada por Phytophthora infestans (Straminipila, Oomycota), é a doença mais destrutiva nas culturas de batata e tomate, podendo comprometer a produção em poucos dias. O patógeno é um organismo heterotálico, com dois grupos de compatibilidade A1 e A2, e reprodução assexuada ou sexuada, quando há o encontro de cepas compatíveis, A1 e A2, pelo contato de gametângios com a consequente formação de oósporos. Este trabalho teve como o objetivo monitorar a ocorrência de P. infestans, quanto ao grupo de compatibilidade, em áreas produtoras de batata e tomate das regiões Sul e Sudeste do Brasil. Foram coletadas 31 amostras nos estados de São Paulo, Paraná e Minas Gerais, durante 2015. As amostras foram colocadas em câmara úmida a 16°C com fotoperíodo de 12 h e, após cinco dias, foram observados os sinais do patógeno ao microscópio estereoscópico e óptico. A partir destas amostras foram realizados isolamentos em meio de cultura V8 com a adição de antibióticos e fungicidas. Para a identificação do grupo de compatibilidade de P. infestans, DNA total foi extraído das 31 amostras, submetidos a PCR com os iniciadores W16-1 (5?AACACGCACAAGGCATATAAATGTA -3?) e W16-2 (5?- GCGTAATGTAGCGTAACAGCTCTC -3?) e sequenciados. Trinta isolados de batata e tomate foram pertencentes ao grupo de compatibilidade A1, enquanto que o grupo de compatibilidade A2 foi detectado em apenas uma amostra de tomateiro proveniente do Estado de São Paulo.

2016
Tipo:  Resumo em anais de congresso (ALICE)
Idioma:  Português
Identificador:  15407

http://www.alice.cnptia.embrapa.br/handle/doc/1068002

http://ainfo.cnptia.embrapa.br/digital/bitstream/item/161617/1/zanotta.pdf
Editor:  In: CONGRESSO BRASILEIRO DE FITOPATOLOGIA, 49., 2016, Maceió. Anais... Maceió: Sociedade Brasileira de Fitopatologia, 2016. Ref. 586.
Relação:  Embrapa Meio Ambiente - Resumo em anais de congresso (ALICE)
Fechar
 

Empresa Brasileira de Pesquisa Agropecuária - Embrapa
Todos os direitos reservados, conforme Lei n° 9.610
Política de Privacidade
Área restrita

Embrapa
Parque Estação Biológica - PqEB s/n°
Brasília, DF - Brasil - CEP 70770-901
Fone: (61) 3448-4433 - Fax: (61) 3448-4890 / 3448-4891 SAC: https://www.embrapa.br/fale-conosco

Valid HTML 4.01 Transitional