Sabiia Seb
PortuguêsEspañolEnglish
Embrapa
        Busca avançada

Botão Atualizar


Botão Atualizar

Ordenar por: RelevânciaAutorTítuloAnoImprime registros no formato resumido
Registros recuperados: 4
Primeira ... 1 ... Última
Imagem não selecionada

Imprime registro no formato completo
Atividade amilolítica e qualidade fisiológica de sementes armazenadas de milho super doce tratadas com ácido giberélico Rev. bras. sementes
Aragão,Carlos Alberto; Dantas,Bárbara França; Alves,Elza; Cataneo,Ana Catarina; Cavariani,Cláudio; Nakagawa,João.
O uso de reguladores de crescimento na fase de germinação melhora o desempenho das plântulas, acelerando a velocidade de emergência e realçando o potencial das sementes de várias espécies, mesmo sob condições adversas. Este trabalho teve como objetivo avaliar a influência do ácido giberélico na atividade amilolítica e no vigor de sementes armazenadas de milho super doce. O experimento foi conduzido nos Laboratórios de Análise de Sementes do Departamento de Produção Vegetal/FCA e no Laboratório de Bioquímica de Plantas do Departamento de Química e Bioquímica/IB da Universidade Estadual Paulista (UNESP/Botucatu), entre os meses de julho e setembro de 2001, onde foram feitas as avaliações da qualidade fisiológica, através dos testes de germinação, vigor e...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Biorreguladores; Zea mays; Milho doce; Alfa-amilase.
Ano: 2003 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-31222003000100008
Imagem não selecionada

Imprime registro no formato completo
Avaliação do vigor de sementes peliculizadas de tomate Rev. bras. sementes
Martinelli-Seneme,Adriana; Martins,Cibele Chalita; Castro,Márcia Maria; Nakagawa,João; Cavariani,Cláudio.
Com o objetivo de verificar a eficiência de diferentes testes de vigor na avaliação da qualidade de sementes peliculizadas de tomate, cinco lotes do híbrido Saladinha foram submetidos aos seguintes testes: germinação; primeira contagem de germinação; emissão de raiz primária (determinada 56, 72, 80 e 96 horas após a instalação do teste de germinação); emergência de plântulas em substrato tipo Plantmax em bandeja de poliestireno; envelhecimento acelerado com água (1g de sementes mantidas a 41ºC por 48 e 72 horas a 100%UR); envelhecimento acelerado com solução saturada de sal (mesmo procedimento do item anterior mas usando solução de NaCl 40% e 76%UR); condutividade elétrica (50 sementes em 25 ml de água destilada a 25ºC e leituras após 2, 4, 6, 8 e 24...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Lycopersicon lycopersicum; Controle de qualidade; Olerícolas.
Ano: 2004 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-31222004000200001
Imagem não selecionada

Imprime registro no formato completo
Comparação entre métodos para a avaliação do vigor de lotes de sementes de couve-brócolos (Brassica oleracea L. var. italica Plenk) Rev. bras. sementes
Martins,Cibele Chalita; Martinelli-Seneme,Adriana; Castro,Marcia Maria; Nakagawa,João; Cavariani,Cláudio.
Os testes de vigor e o teste de germinação são componentes essenciais no controle de qualidade das empresas de produção de sementes. Com o objetivo de verificar a eficiência de diferentes testes de vigor e de variações de suas metodologias na avaliação da qualidade de sementes de couve-brócolos visando diferenciação de lotes e previsão de emergência em bandeja, cinco lotes de sementes do híbrido Flórida foram submetidos aos seguintes testes: germinação; primeira contagem de germinação; emissão de raiz primária (após 48, 56, 72, 80 e 96 h após a instalação do teste de germinação); emergência de plântulas em substrato; envelhecimento acelerado com água (1g de sementes mantidas a 41ºC por 48 e 72 h a 100%UR); envelhecimento acelerado com solução saturada de...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Controle de qualidade; Condutividade elétrica; Envelhecimento acelerado; Olerícolas.
Ano: 2002 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-31222002000200016
Imagem não selecionada

Imprime registro no formato completo
Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho Rev. bras. sementes
Dantas,Bárbara França; Aragão,Carlos Alberto; Araújo-Junior,João Pessoa; Rodrigues,João Domingos; Cavariani,Cláudio; Nakagawa,João.
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina;...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Zea mays; Sementes; Alfa-amilase; RT-PCR.
Ano: 2002 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-31222002000200019
Registros recuperados: 4
Primeira ... 1 ... Última
 

Empresa Brasileira de Pesquisa Agropecuária - Embrapa
Todos os direitos reservados, conforme Lei n° 9.610
Política de Privacidade
Área restrita

Embrapa
Parque Estação Biológica - PqEB s/n°
Brasília, DF - Brasil - CEP 70770-901
Fone: (61) 3448-4433 - Fax: (61) 3448-4890 / 3448-4891 SAC: https://www.embrapa.br/fale-conosco

Valid HTML 4.01 Transitional