Sabiia Seb
PortuguêsEspañolEnglish
Embrapa
        Busca avançada

Botão Atualizar


Botão Atualizar

Ordenar por: 

RelevânciaAutorTítuloAnoImprime registros no formato resumido
Registros recuperados: 2
Primeira ... 1 ... Última
Imagem não selecionada

Imprime registro no formato completo
Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response BJMBR
Dang,N.N.; Pang,S.G.; Song,H.Y.; An,L.G.; Ma,X.L..
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5,...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Atopic dermatitis; T helper 2 cytokines; Filaggrin silencing; Pathogenesis.
Ano: 2015 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000100039
Imagem não selecionada

Imprime registro no formato completo
High prevalence of methicillin resistance and PVL genes among Staphylococcus aureus isolates from the nares and skin lesions of pediatric patients with atopic dermatitis BJMBR
Cavalcante,F.S.; Abad,E.D.; Lyra,Y.C.; Saintive,S.B.; Ribeiro,M.; Ferreira,D.C.; Santos,K.R.N. dos.
Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmec typing, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Atopic dermatitis; Staphylococcus aureus; Nasal colonization; Skin lesions; SCORAD.
Ano: 2015 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000700588
Registros recuperados: 2
Primeira ... 1 ... Última
 

Empresa Brasileira de Pesquisa Agropecuária - Embrapa
Todos os direitos reservados, conforme Lei n° 9.610
Política de Privacidade
Área restrita

Embrapa
Parque Estação Biológica - PqEB s/n°
Brasília, DF - Brasil - CEP 70770-901
Fone: (61) 3448-4433 - Fax: (61) 3448-4890 / 3448-4891 SAC: https://www.embrapa.br/fale-conosco

Valid HTML 4.01 Transitional