Sabiia Seb
PortuguêsEspañolEnglish
Embrapa
        Busca avançada

Botão Atualizar


Botão Atualizar

Ordenar por: 

RelevânciaAutorTítuloAnoImprime registros no formato resumido
Registros recuperados: 26
Primeira ... 12 ... Última
Imagem não selecionada

Imprime registro no formato completo
Clinical and molecular aspects of severe malaria 42
Kirchgatter,Karin; Del Portillo,Hernando A..
The erythrocytic cycle of Plasmodium falciparum presents a particularity in relation to other Plasmodium species that infect man. Mature trophozoites and schizonts are sequestered from the peripheral circulation due to adhesion of infected erythrocytes to host endothelial cells. Modifications in the surface of infected erythrocytes, termed knobs, seem to facilitate adhesion to endothelium and other erythrocytes. Adhesion provides better maturation in the microaerophilic venous atmosphere and allows the parasite to escape clearance by the spleen which recognizes the erythrocytes loss of deformability. Adhesion to the endothelium, or cytoadherence, has an important role in the pathogenicity of the disease, causing occlusion of small vessels and contributing...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Severe malaria; Plasmodium falciparum; PfEMP1; Pathogenesis; Cytoadherence; Rosetting; Antigenic variation.
Ano: 2005 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0001-37652005000300008
Imagem não selecionada

Imprime registro no formato completo
Fluorescent antibody test, quantitative polymerase chain reaction pattern and clinical aspects of rabies virus strains isolated from main reservoirs in Brazil 55
Appolinário,Camila; Allendorf,Susan Dora; Vicente,Acácia Ferreira; Ribeiro,Bruna Devidé; Fonseca,Clóvis Reinaldo da; Antunes,João Marcelo; Peres,Marina Gea; Kotait,Ivanete; Carrieri,Maria Luiza; Megid,Jane.
ABSTRACTRabies virus (RABV) isolated from different mammals seems to have unique characteristics that influence the outcome of infection. RABV circulates in nature and is maintained by reservoirs that are responsible for the persistence of the disease for almost 4000 years. Considering the different pattern of pathogenicity of RABV strains in naturally and experimentally infected animals, the aim of this study was to analyze the characteristics of RABV variants isolated from the main Brazilian reservoirs, being related to a dog (variant 2),Desmodus rotundus (variant 3), crab eating fox, marmoset, and Myotis spp. Viral replication in brain tissue of experimentally infected mouse was evaluated by two laboratory techniques and the results were compared to...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Pathogenesis; QRT-PCR; FAT; Rabies; Variants.
Ano: 2015 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1413-86702015000500479
Imagem não selecionada

Imprime registro no formato completo
Japanese encephalitis: a review of the Indian perspective 55
Tiwari,Sarika; Singh,Rishi Kumar; Tiwari,Ruchi; Dhole,Tapan N..
Japanese encephalitis virus (JEV) causes Japanese encephalitis, which is a leading form of viral encephalitis in Asia, with around 50,000 cases and 10,000 deaths per year in children below 15 years of age. The JEV has shown a tendency to extend to other geographic regions. Case fatality averages 30% and a high percentage of the survivors are left with permanent neuropsychiatric sequelae. Currently, there is no cure for JEV, and treatment is mainly supportive. Patients are not infectious, but should avoid further mosquito bites. A number of antiviral agents have been investigated; however, none of these have convincingly been shown to improve the outcome of JEV. In this review, the current knowledge of the epidemiology and the pathogenesis of this deadly...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Epidemiology; Pathogenesis; Vector born diseases; Epidemics.
Ano: 2012 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1413-86702012000600011
Imagem não selecionada

Imprime registro no formato completo
GBV-C/HGV and HIV-1 coinfection 55
Maidana,Maria Teresa; Sabino,Ester Cerdeira; Kallas,Esper Georges.
An interesting interaction pattern has been found between HIV-1 and GBV-C/HGV, resulting in protection against progression to AIDS. The mechanisms involved in this interaction remain to be clarified. We examined the current knowledge concerning this coinfection and developed hypotheses to explain its effects. A better understanding of this interaction could result in new concepts, which may lead to new strategies to control HIV-1 replication and progression to AIDS.
Tipo: Info:eu-repo/semantics/article Palavras-chave: HIV; HGV; GBV-C; Pathogenesis; Review.
Ano: 2005 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1413-86702005000200001
Imagem não selecionada

Imprime registro no formato completo
Genotypic study documents divergence in the pathogenesis of bloodstream infection related central venous catheters in neonates 55
Brito,Cristiane Silveira; Ribas,Rosineide Marques; Resende,Daiane Silva; Brito,Denise Von Dolinger de; Abdallah,Vânia Olivetti Steffen; Santos,Kátia Regina Netto dos; Cavalcante,Fernanda Sampaio; Matos,Pricilla Dias Moura de; Gontijo Filho,Paulo P..
OBJECTIVE: To investigate the pathogenesis of bloodstream infection by Staphylococcus epidermidis, using the molecular epidemiology, in high-risk neonates. METHODS: We conducted a prospective study of a cohort of neonates with bloodstream infection using central venous catheters for more than 24 h. "National Healthcare Safety Network" surveillance was conducted. Genotyping was performed by DNA fingerprinting and mecA genes and icaAD were detected by multiplex-PCR. RESULTS: From April 2006 to April 2008, the incidence of bloodstream infection and central venous catheter-associated bloodstream infection was 15.1 and 13.0/1000 catheter days, respectively, with S. epidermidis accounting for 42.9% of episodes. Molecular analysis was used to document the...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Neonates; Central venous catheter; Pathogenesis.
Ano: 2014 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1413-86702014000400387
Imagem não selecionada

Imprime registro no formato completo
Study of biological characteristics of Pseudomonas aeruginosa strains isolated from patients with cystic fibrosis and from patients with extra-pulmonary infections 55
Stehling,Eliana Guedes; Silveira,Wanderley Dias da; Leite,Domingos da Silva.
A total of 120 strains of Pseudomonas aeruginosa, isolated from cystic fibrosis (CF) patients (n = 80) and from patients having extra-pulmonary infections (n = 40) were studied regarding the presence of some virulence factors (hemolysin, gelatinase and elastase production) and presence of the algD and algU genes as detected by polymerase chain reaction-PCR. There was not a significant difference for the production of gelatinase and hemolysin between non-mucoid strains from CF patients and other isolates from extra-pulmonary infections and mucoid strains. The production of elastase was found to be significant among these strains. The algD gene was detected by PCR in all studied strains but the algU gene was detected only in 25% of the mucoid strains....
Tipo: Info:eu-repo/semantics/article Palavras-chave: Pseudomonas aeruginosa; Biological characterization; Pathogenesis; Cystic fibrosis; Extra-pulmonary infections.
Ano: 2008 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1413-86702008000100018
Imagem não selecionada

Imprime registro no formato completo
Cytokine expression patterns and mesenchymal stem cell karyotypes from the bone marrow microenvironment of patients with myelodysplastic syndromes 56
Xiong,H.; Yang,X.Y.; Han,J.; Wang,Q.; Zou,Z.L..
The purpose of this study was to explore cytokine expression patterns and cytogenetic abnormalities of mesenchymal stem cells (MSCs) from the bone marrow microenvironment of Chinese patients with myelodysplastic syndromes (MDS). Bone marrow samples were obtained from 30 cases of MDS (MDS group) and 30 healthy donors (control group). The expression pattern of cytokines was detected by customized protein array. The karyotypes of MSCs were analyzed using fluorescence in situ hybridization. Compared with the control group, leukemia inhibitory factor, stem cell factor (SCF), stromal cell-derived factor (SDF-1), bone morphogenetic protein 4, hematopoietic stem cell (HSC) stimulating factor, and transforming growth factor-β in the MDS group were significantly...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Bone marrow microenvironment; Cytokine; Mesenchymal stem cell; Chromosome; Pathogenesis.
Ano: 2015 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000300207
Imagem não selecionada

Imprime registro no formato completo
Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response 56
Dang,N.N.; Pang,S.G.; Song,H.Y.; An,L.G.; Ma,X.L..
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5,...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Atopic dermatitis; T helper 2 cytokines; Filaggrin silencing; Pathogenesis.
Ano: 2015 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000100039
Imagem não selecionada

Imprime registro no formato completo
Gene expression profiling analysis of lung adenocarcinoma 56
Xu,H.; Ma,J.; Wu,J.; Chen,L.; Sun,F.; Qu,C.; Zheng,D.; Xu,S..
The present study screened potential genes related to lung adenocarcinoma, with the aim of further understanding disease pathogenesis. The GSE2514 dataset including 20 lung adenocarcinoma and 19 adjacent normal tissue samples from 10 patients with lung adenocarcinoma aged 45-73 years was downloaded from Gene Expression Omnibus. Differentially expressed genes (DEGs) between the two groups were screened using the t-test. Potential gene functions were predicted using functional and pathway enrichment analysis, and protein-protein interaction (PPI) networks obtained from the STRING database were constructed with Cytoscape. Module analysis of PPI networks was performed through MCODE in Cytoscape. In total, 535 upregulated and 465 downregulated DEGs were...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Lung adenocarcinoma; Pathogenesis; Differentially expressed genes; Protein-protein interaction; Network module.
Ano: 2016 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2016000300601
Imagem não selecionada

Imprime registro no formato completo
The role of necroptosis in neurosurgical diseases 56
Liu,T.; Bao,Y.H.; Wang,Y.; Jiang,J.Y..
Programmed necrosis or necroptosis is an alternative form of cell death that is executed through a caspase-independent pathway. Necroptosis has been implicated in many pathological conditions. Genetic or pharmacological inhibition of necroptotic signaling has been shown to confer neuroprotection after traumatic and ischemic brain injury. Therefore, the necroptotic pathway represents a potential target for neurological diseases that are managed by neurosurgeons. In this review, we summarize recent advances in the understanding of necroptotic signaling pathways and explore the role of necroptotic cell death in craniocerebral trauma, brain tumors, and cerebrovascular diseases.
Tipo: Info:eu-repo/semantics/article Palavras-chave: Molecular mechanism; Pathogenesis; Programmed cell death; Therapy.
Ano: 2015 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2015000400292
Imagem não selecionada

Imprime registro no formato completo
A bovine herpesvirus 5 recombinant defective in the thymidine kinase (TK) gene and a double mutant lacking TK and the glycoprotein E gene are fully attenuated for rabbits 56
Silva,S.C.; Brum,M.C.S.; Weiblen,R.; Flores,E.F.; Chowdhury,S.I..
Bovine herpesvirus 5 (BoHV-5), the agent of herpetic meningoencephalitis in cattle, is an important pathogen of cattle in South America and several efforts have been made to produce safer and more effective vaccines. In the present study, we investigated in rabbits the virulence of three recombinant viruses constructed from a neurovirulent Brazilian BoHV-5 strain (SV507/99). The recombinants are defective in glycoprotein E (BoHV-5gEΔ), thymidine kinase (BoHV-5TKΔ) and both proteins (BoHV-5gEΔTKΔ). Rabbits inoculated with the parental virus (N = 8) developed neurological disease and died or were euthanized in extremis between days 7 and 13 post-infection (pi). Infectivity was detected in several areas of their brains. Three of 8 rabbits inoculated with the...
Tipo: Info:eu-repo/semantics/article Palavras-chave: BoHV-5; GE and TK deletion mutants; Pathogenesis; Virulence; Vaccine candidate.
Ano: 2010 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-879X2010000200005
Imagem não selecionada

Imprime registro no formato completo
Porcine circovirus 2 (PCV2) increases the expression of endothelial adhesion/junction molecules 58
Marks,Fernanda S.; Almeida,Laura L.; Driemeier,David; Canal,Cláudio; Barcellos,David E.S.N.; Guimarães,Jorge A.; Reck,José.
Abstract Porcine circovirus type 2 (PCV2) is the primary causative agent of porcine circovirus disease, a complex multisystem syndrome in domestic pigs. Despite the significant economic losses caused by porcine circovirus disease, the mechanisms of pathogenesis underlying the clinical findings remain largely unclear. As various reports have highlighted the potential key role of vascular lesions in the pathogenesis of porcine circovirus disease, the aim of this work was to investigate effects of PCV2 infection on vascular endothelial cells, focusing on cell viability and expression of adhesion/junction molecules. PCV2 infection reduced endothelial cell viability, while viral infection did not affected the viability of several other classical cell lines....
Tipo: Info:eu-repo/semantics/article Palavras-chave: Swine; Infectious diseases; Pathogenesis; Viral infection; Cell adhesion.
Ano: 2016 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1517-83822016000400870
Imagem não selecionada

Imprime registro no formato completo
An in-house multiplex pcr method to detect of putative virulence factors in Aeromonas species 58
Aguilera-Arreola,Ma. Guadalupe; Martínez,Alma Aidee Carmona; Castro-Escarpulli,Graciela.
A pentaplex PCR was developed and optimised to detect the genes that encode the five most important putative virulence factors in Aeromonas isolates. It seems to be more efficient than previously reported techniques and promises to be a powerful tool for more accurate risk assessments and for monitoring pathogenic strains.
Tipo: Info:eu-repo/semantics/article Palavras-chave: Pentaplex-PCR; Virulence potential; Pathogenesis; Aeromonas.
Ano: 2011 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1517-83822011000400011
Imagem não selecionada

Imprime registro no formato completo
Virulence of oral Fusobacterium nucleatum from humans and non-human primates in mice 58
Gaetti-Jardim Júnior,Elerson; Luvizotto,Maria C. Rui; Avila-Campos,Mario J..
The lethal action in Balb/c mice of 80 oral Fusobacterium nucleatum recovered from patients with adult periodontitis, healthy subjects or Cebus apella monkeys was studied. Mice were inoculated intraperitoneally with each bacterial inoculum of 5 x 10(8) CFU/ml. All the clinical isolates induced weight and coordinated movements loss. Pathological alterations in liver, CNS, heart, and kidney with inflammatory reactions or vascular congestion were observed. Of all the tested F. nucleatum isolates, 61.2% from periodontal patients, 57.1% from healthy subjects and 60% from monkeys, were capable of killing the mice in 48h. The clinical isolates were significantly more pathogenic than F. nucleatum ATCC 10953 or ATCC 25586. B. fragilis ATCC 23745 showed lethality...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Fusobacterium nucleatum; Pathogenesis; Human and non-human primates.
Ano: 2000 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1517-83822000000200016
Imagem não selecionada

Imprime registro no formato completo
Glutathione S-transferase mu 1 (GSTM1) and theta 1 (GSTT1) genetic polymorphisms and atopic asthma in children from Southeastern Brazil 74
Lima,Carmen Silvia Passos; Néri,Iramaia Angélica; Lourenço,Gustavo Jacob; Faria,Isabel Cristina Jacinto; Ribeiro,José Dirceu; Bertuzzo,Carmen Silvia.
Xenobiotics can trigger degranulation of eosinophils and mast cells. In this process, the cells release several substances leading to bronchial hyperactivity, the main feature of atopic asthma (AA). GSTM1 and GSTT1 genes encode enzymes involved in the inactivation of these compounds. Both genes are polymorphic in humans and have a null variant genotype in which both the gene and corresponding enzyme are absent. An increased risk for disease in individuals with the null GST genotypes is therefore, but this issue is controversial. The aim of this study was to investigate the influence of the GSTM1 and GSTT1 genotypes on the occurrence of AA, as well as on its clinical manifestations. Genomic DNA from 86 patients and 258 controls was analyzed by polymerase...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Atopic asthma; Pathogenesis; GSTM1 gene; GSTT1 gene.
Ano: 2010 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1415-47572010000300007
Imagem não selecionada

Imprime registro no formato completo
Combination of a pesticide exposure and a bacterial challenge: In vivo effects on immune response of Pacific oyster, Crassostrea gigas (Thunberg) 5
Gagnaire, Beatrice; Gay, Melanie; Huvet, Arnaud; Daniel, Jean-yves; Saulnier, Denis; Renault, Tristan.
To assess the impact of pollution induced by pesticides on Pacific oyster, Crassostrea gigas, health in France, in vivo effects of combined pesticide exposure and bacterial challenge on cell activities and gene expression in hemocytes were tested using flow cytometry and real-time PCR. As a first step, an in vivo model of experimental contamination was developed. Pacific oysters were exposed to a mixture of eight pesticides (atrazine, glyphosate, alachlor, metolachlor, fosetyl-alumimium, terbuthylazine, diuron and carbaryl) at environmentally relevant concentrations over a 7-day period. Hemocyte parameters (cell mortality, enzyme activities and phagocytosis) were monitored using flow cytometry and gene expression was evaluated by real-time PCR (RT-PCR)....
Tipo: Text Palavras-chave: Gene expression; Flow cytometry; Vibrio splendidus; Pathogenesis; Phagocytosis; Hemocyte; Pesticides; Bivalve immunity; Crassostrea gigas; Pacific oyster.
Ano: 2007 URL: http://archimer.ifremer.fr/doc/2007/publication-3022.pdf
Imagem não selecionada

Imprime registro no formato completo
Bacterial disease in marine bivalves, a review of recent studies: Trends and evolution 5
Paillard, Christine; Leroux, Frederique; Borrego, Juan.
The main microbial diseases affecting marine cultured bivalves have been revised on the basis of the etiologic agents, pathogenesis and pathogenicity. Several recent bivalve-interaction models have been studied, including Pecten larvae-Vibrio pectinicida, brown ring disease, juvenile oyster disease, Pacific oyster nocardiosis and summer mortalities of oysters. In addition, the taxonomy and phylogeny of new potential bivalve pathogens and their virulence factors have been established. Facing the difficulty of identifying bacterial strains associated with molluscan diseases (mainly vibriosis), polyphasic approaches have been developed to correlate the phenotype and genotype of potential pathogens. By evaluating likely virulence mechanisms, developing...
Tipo: Text Palavras-chave: Diagnostic tools; Virulence factors; Pathogenicity; Pathogenesis; Etiology; Bivalve mollusc; Vibriosis.
Ano: 2004 URL: http://archimer.ifremer.fr/doc/2004/publication-407.pdf
Imagem não selecionada

Imprime registro no formato completo
Species-specific mechanisms of cytotoxicity toward immune cells determine the successful outcome of Vibrio infections 5
Rubio, Tristan; Oyanedel, Daniel; Labreuche, Yannick; Toulza, Eve; Luo, Xing; Bruto, Maxime; Chaparro, Cristian; Torres, Marta; De Lorgeril, Julien; Haffner, Philippe; Vidal-dupiol, Jeremie; Lagorce, Arnaud; Petton, Bruno; Mitta, Guillaume; Jacq, Annick; Le Roux, Frederique; Charriere, Guillaume; Destoumieux-garzon, Delphine.
Vibrio species cause infectious diseases in humans and animals, but they can also live as commensals within their host tissues. How Vibrio subverts the host defenses to mount a successful infection remains poorly understood, and this knowledge is critical for predicting and managing disease. Here, we have investigated the cellular and molecular mechanisms underpinning infection and colonization of 2 virulent Vibrio species in an ecologically relevant host model, oyster, to study interactions with marine Vibrio species. All Vibrio strains were recognized by the immune system, but only nonvirulent strains were controlled. We showed that virulent strains were cytotoxic to hemocytes, oyster immune cells. By analyzing host and bacterial transcriptional...
Tipo: Text Palavras-chave: T6SS; Toxin; Dual RNA-seq; Cytolysis; Pathogenesis.
Ano: 2019 URL: https://archimer.ifremer.fr/doc/00507/61837/65900.pdf
Imagem não selecionada

Imprime registro no formato completo
Bacterial diseases in marine bivalves 5
Travers, Marie-agnes; Miller, Katherine Boettcher; Roque, Ana; Friedman, Carolyn S..
Bivalve aquaculture is seriously affected by many bacterial pathogens that cause high losses in hatcheries as well as in natural beds. A number of Vibrio species, but also members of the genera Nocardia and Roseovarius, are considered important pathogens in aquaculture. The present work provides an updated overview of main diseases and implicated bacterial species affecting bivalves. This review focuses on aetiological agents, their diversity and virulence factors, the diagnostic methods available as well as information on the dynamics of the host-parasite relationship.
Tipo: Text Palavras-chave: Vibrio; Nocardia; Roseovarius; Rickettsia; Pathogenesis; Diagnostic.
Ano: 2015 URL: http://archimer.ifremer.fr/doc/00274/38532/37049.pdf
Imagem não selecionada

Imprime registro no formato completo
Cellular and molecular hemocyte responses of the Pacific oyster, Crassostrea gigas, following bacterial infection with Vibrio aestuarianus strain 01/32 5
Labreuche, Yannick; Lambert, Christophe; Soudant, Philippe; Boulo, Viviane; Huvet, Arnaud; Nicolas, Jean-louis.
The strategies used by bacterial pathogens to circumvent host defense mechanisms remain largely undefined in bivalve molluscs. In this study, we investigated experimentally the interactions between the Pacific oyster (Crassostrea gigas) immune system and Vibrio aestuarianus strain 01/32, a pathogenic bacterium originally isolated from moribund oysters. First, an antibiotic-resistant V. aestuarianus strain was used to demonstrate that only a limited number of bacterial cells was detected in the host circulatory system, suggesting that the bacteria may localize in some organs. Second, we examined the host defense responses to V. aestuarianus at the cellular and molecular levels, using flow-cytometry and real-time PCR techniques. We showed that hemocyte...
Tipo: Text Palavras-chave: Crassostrea gigas; Oyster; Pathogenesis; Vibrio aestuarianus; Bivalve immunity.
Ano: 2006 URL: http://archimer.ifremer.fr/doc/2006/publication-2182.pdf
Registros recuperados: 26
Primeira ... 12 ... Última
 

Empresa Brasileira de Pesquisa Agropecuária - Embrapa
Todos os direitos reservados, conforme Lei n° 9.610
Política de Privacidade
Área restrita

Embrapa
Parque Estação Biológica - PqEB s/n°
Brasília, DF - Brasil - CEP 70770-901
Fone: (61) 3448-4433 - Fax: (61) 3448-4890 / 3448-4891 SAC: https://www.embrapa.br/fale-conosco

Valid HTML 4.01 Transitional