Sabiia Seb
PortuguêsEspañolEnglish
Embrapa
        Busca avançada

Botão Atualizar


Botão Atualizar

Ordenar por: 

RelevânciaAutorTítuloAnoImprime registros no formato resumido
Registros recuperados: 100
Primeira ... 12345 ... Última
Imagem não selecionada

Imprime registro no formato completo
Rabies virus in a pregnant naturally infected southern yellow bat (Lasiurus ega) J. Venom. Anim. Toxins incl. Trop. Dis.
Allendorf,SD; Albas,A; Cipriano,JRB; Antunes,JMAP; Appolinário,CM; Peres,MG; da Rosa,AR; Sodré,MM; Megid,J.
Current knowledge on bat lyssavirus infections in their native hosts is limited and little is known about the virulence, virus dissemination and transmission among free-living insectivorous bats. The present study is a brief description of rabies virus (RABV) dissemination in tissues of a naturally infected pregnant southern yellow bat (Lasiurus ega) and its fetuses, obtained by reverse-transcriptase polymerase chain reaction (RT-PCR). The RT-PCR was positive in samples from the brain, salivary gland, tongue, lungs, heart, kidneys and liver. On the other hand, the placenta, three fetuses, spleen, intestine and brown fat tissue tested negative. This research demonstrated the absence of rabies virus in the fetuses, thus, in this specific case, the...
Tipo: Info:eu-repo/semantics/other Palavras-chave: Rabies; Bats; Vertical transmission; RT-PCR.
Ano: 2011 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1678-91992011000200014
Imagem não selecionada

Imprime registro no formato completo
Assessment of cytokine values in serum by RT-PCR in HIV-1 infected individuals with and without highly active anti-retroviral therapy (HAART) J. Venom. Anim. Toxins incl. Trop. Dis.
Meira,DA; Almeida,RAMB; Barbosa,AN; de Souza,LR; Olivo,TET; Henriques,RMS; Golim,MA; Araújo Jr,JP; Nagoshi,LR; Orikaza,CM; Calvi,SA.
A cross-sectional study was performed on HIV-1 infected individuals with or without antiretroviral treatment (ARV) in the AIDS Day Hospital, Botucatu Medical School, UNESP. Between August 2004 and October 2005, 73 HIV-1 infected individuals were divided into three groups: infected individuals with or without AIDS who had never received ARV (G1 = 15); patients on HAART that had had plasma HIV-1 RNA viral load (VL) equal to or greater than 50 copies/mL (G2 = 27); and patients on HAART with undetectable VL for at least the past six months (G3 = 31). There was also an additional group that comprised blood donors without any sign of the disease and with negative HIV serum tests (G4 = 20), which was the control group. Serum cytokine levels (values in pg/mL) were...
Tipo: Info:eu-repo/semantics/article Palavras-chave: RT-PCR; ELISA; Cytokines; HIV; AIDS; HAART; Apoptosis.
Ano: 2008 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1678-91992008000400011
Imagem não selecionada

Imprime registro no formato completo
Detection of three Allexivirus species infecting garlic in Brazil PAB
Melo Filho,Péricles de Albuquerque; Nagata,Tatsuya; Dusi,André Nepomuceno; Buso,José Amauri; Torres,Antonio Carlos; Eiras,Marcelo; Resende,Renato de Oliveira.
Garlic viruses often occur in mixed infections under field conditions. In this study, garlic samples collected in three geographical areas of Brazil were tested by Dot-ELISA for the detection of allexiviruses using monoclonal specific antibodies to detect Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C) and a polyclonal antiserum able to detect the three virus species mentioned plus Garlic virus D (GarV-D). The detected viruses were biologically isolated by successive passages through Chenopodium quinoa. Reverse Transcriptase Polimerase Chain Reaction (RT-PCR) was performed using primers designed from specific regions of the coat protein genes of Japanese allexiviruses available in the Genetic Bank of National Center of...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Allium sativum; Virus detection; Coat protein; Dot-ELISA; RT-PCR.
Ano: 2004 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2004000800002
Imagem não selecionada

Imprime registro no formato completo
Variabilidade genética de Sugarcane mosaic virus, causando mosaico em milho no Brasil PAB
Gonçalves,Marcos Cesar; Galdeano,Diogo Manzano; Maia,Ivan de Godoy; Chagas,César Martins.
O objetivo deste trabalho foi caracterizar biológica e molecularmente três isolados de Sugarcane mosaic virus (SCMV) de lavouras de milho, analisá-los filogeneticamente e discriminar polimorfismos do genoma. Plantas com sintomas de mosaico e nanismo foram coletadas em lavouras de milho, no Estado de São Paulo e no Município de Rio Verde, GO, e seus extratos foliares foram inoculados em plantas indicadoras e submetidos à análise sorológica com antissoros contra o SCMV, contra o Maize dwarf mosaic virus (MDMV) e contra o Johnsongrass mosaic virus (JGMV). Mudas de sorgo 'Rio' e 'TX 2786' apresentaram sintomas de mosaico após a inoculação dos três isolados, e o DAS-ELISA confirmou a infecção pelo SCMV. O RNA total foi extraído e usado para amplificação por...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Potyviridae; Zea mays; Mosaico comum do milho; RFLP; RT-PCR.
Ano: 2011 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-204X2011000400004
Imagem não selecionada

Imprime registro no formato completo
Primer reporte de Tobacco mosaic virus (TMV) y Poinsettia mosaic virus (PnMV) en nochebuena de sol (Euphorbia pulcherrima Willd. Ex Klotzch) en México Phyton
Ocampo Ocampo,T; Ochoa Martínez,DL; Ramírez Rojas,S; Valdovinos Ponce,G; Nava Díaz,C.
El Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP), a través del Campo Experimental "Zacatepec" en el estado Morelos, inició un programa de mejoramiento genético de plantas silvestres y semicultivadas de nochebuena ("nochebuena de sol"). Dicho programa requiere de la generación de una base de datos fitosanitarios con tolerancia a los principales patógenos. México no cuenta con información sobre las enfermedades causadas por virus en la nochebuena de sol, por lo que el objetivo de la presente investigación fue generar datos preliminares sobre los virus asociados a estos materiales. Con base en los resultados obtenidos en las técnicas DAS-ELISA y RT-PCR, se reportan por primera vez en México los virus Tobacco mosaic virus...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Nochebuena silvestre; Nochebuena semicultivada; Virus; DAS-ELISA; RT-PCR.
Ano: 2013 URL: http://www.scielo.org.ar/scielo.php?script=sci_arttext&pid=S1851-56572013000200011
Imagem não selecionada

Imprime registro no formato completo
Modulation of Physiologic Parameters in Molted Isa Brown Laying-Hens by Glutamine + Glutamic Acid Supplementation Rev. Bras. Ciênc. Avic.
Morales,W; Rodríguez,V; Garcia,NV.
ABSTRACT Feed costs are the main limiting factors in poultry industry and alternative sources of food and/or feed supplements to optimize the bird´s life cycle and to extend their production period need to be explored. This study evaluated morphometric parameters of the small intestine and gonadotropin transcript levels in Isa Brown laying hens supplemented with glutamine + glutamic acid (Aminogut®) during a second production cycle. Molting was induced and groups of 100 hens each, were supplemented with 0, 0.8, 1.6 or 2.4% Aminogut® in their diet. At the end of the experimental period, tissue sections from duodenum, jejunum and ileum were processed by the Hematoxylin-Eosin technique and samples from hypothalamus and hypophysis were collected for RT-PCR...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Amino acids; Gonadotropin; Morphometry; RT-PCR; Small intestine.
Ano: 2018 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1516-635X2018000200255
Imagem não selecionada

Imprime registro no formato completo
Correlation Analysis of Relative Expression of Apob, Adfp and Fatp1 with Lipid Metabolism in Daweishan Mini Chickens Rev. Bras. Ciênc. Avic.
Decai,X; Zhiyong,Z; Bin,Z; Zhongcheng,H; Quanshu,W; Jing,L.
ABSTRACT Quantitative RT-PCR was applied to measure the relative expression levels of the adipose differentiation-related protein (ADFP) gene, fatty acid transport protein 1 (FATP1) gene and apolipoprotein B (ApoB) gene in subcutaneous fat, abdominal fat, liver and muscle at five growth stages (28, 49, 70, 91 and 112 d) to determine the effect of the expression ofthese genes on fat deposition in Daweishan Mini chickens.The relative expression of ADFP gene mRNA in the abdominal fat andthe liver was significantly different between 49 d and 70 d (p<0.05). The relative ApoB gene expression on 91d was higher in the liver, followed by muscles,subcutaneous fat, and abdominal fat, and was significantly higher in the liver than in the other three tissues. FATP1...
Tipo: Info:eu-repo/semantics/article Palavras-chave: ADFP; FATP1; ApoB; Daweishan Mini chicken; Fat traits; RT-PCR.
Ano: 2017 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1516-635X2017000100151
Imagem não selecionada

Imprime registro no formato completo
Investigation of Influenza A, West Nile and Newcastle Disease Viruses in Birds from the Pantanal Wetlands of Mato Grosso, Brazil Rev. Bras. Ciênc. Avic.
Pinto,LB; Ometto,T; Araújo,J; Thomazelli,LM; Seixas,MM; Barbosa,CM; Ramos,DGS; Melo,ALT; Pinho,JB; Durigon,EL; Aguiar,DM.
ABSTRACT The Pantanal is the world's largest wetland biome with a seasonal flood pulse that attracts a great diversity of birds, many of which are migratory. Birds can be natural reservoirs Influenza A, West Nile and Newcastle Disease viruses. However, the occurrence of carriers for these viruses in the Pantanal was not verified yet. The present study evaluated the occurrence of natural infection by Influenza A, WN and ND virus of birds in the municipality of Poconé, a subregion of the Pantanal in the state of Mato Grosso, Brazil. A total of 76 birds belonging to 11 orders and 20 families were captured using mist nets. The most representative order was Passeriformes, followed by the other nine orders, which included Columbiformes, Psittaciformes,...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Pantanal birds; Infectious Diseases; RT-PCR; QRT-PCR; Virus.
Ano: 2016 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1516-635X2016000200291
Imagem não selecionada

Imprime registro no formato completo
Effect of maternally-derived antibodies on the performance and immunity of broilers induced by in ovo or post-hatching immunizations with a live vaccine against infectious bursal disease Rev. Bras. Ciênc. Avic.
Michell,BC; Gomes,AD; Baião,NC; Resende,M; Lara,LJC; Martins,NRS.
The interference of low or high maternal antibodies titers on the attenuated infectious bursal disease (IBD) virus (IBDV) vaccine infection and its effects on the performance of broilers vaccinated at the 18th day of incubation (in ovo), at one day of age (subcutaneously-SC), or at 15 days of age (drinking water-DW) were investigated. After a series of three live vaccinations, breeders were given or not an IBD oil emulsion vaccine (IBD-OEV) prior to sexual maturity. At day 18 of incubation (in ovo), a commercial vaccine containing HVT and an intermediate IBDV strain or the single HVT vaccine was given. An intermediate IBDV vaccine was given SC at one day of age, or at 15 days of age via DW. The progeny of unvaccinated breeders presented higher neutralizing...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Attenuated IBDV; Attenuated IBDV neutralization; Broiler chicken; Infectious bursal disease; Infectious bursal disease virus; IBDV; In-ovo vaccination; Maternal antibody; RT-PCR; Serum neutralization; Vaccination versus performance.
Ano: 2009 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1516-635X2009000100009
Imagem não selecionada

Imprime registro no formato completo
Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho Rev. bras. sementes
Dantas,Bárbara França; Aragão,Carlos Alberto; Araújo-Junior,João Pessoa; Rodrigues,João Domingos; Cavariani,Cláudio; Nakagawa,João.
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina;...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Zea mays; Sementes; Alfa-amilase; RT-PCR.
Ano: 2002 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0101-31222002000200019
Imagem não selecionada

Imprime registro no formato completo
Molecular cloning and expression patterns of the Vasa gene from Rana nigromaculata (Amphibia: Anura) Rev. Bras. Zool.
Jia,Rui; Nie,Liu-Wang; Wang,Ning; Wang,Jingjing.
The Vasa protein is a member of the DEAD (Asp-Glu-Alu-Asp) box family of ATP-dependent RNA helicases. The Vasa gene is specifically expressed in germ-line cells of many metazoans and is known to play a critical role in gametogenesis and reproductive regulation. In this paper, we isolate the full length cDNA sequence of the Vasa gene from the frog Rana nigromaculata Hallowell, 1861. The open reading frame (ORF) encoding 398 amino acid residues has nine conserved motifs. According to the similarities at the amino acid sequenceythe phylogenetic analysis of Vasa gene was consistent with the evolution relationships from chordates to mammals. Furthermore, the expression pattern analysis of RnVasa mRNA, using the technique of Reverse Transcriptase-Polymerase...
Tipo: Info:eu-repo/semantics/article Palavras-chave: DEAD-box; Phylogenetic analysis; RT-PCR.
Ano: 2009 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1984-46702009000200014
Imagem não selecionada

Imprime registro no formato completo
Feed additives can differentially modulate NF-κB (RelA/p65), IGF-1, GLUT2, and SGLT1 gene expression in porcine jejunal explants R. Bras. Zootec.
Silveira,Hebert; Melo,Antonio Diego Brandão; Bortoluzzi,Cristiano; Costa,Leandro Batista; Rostagno,Marcos Horácio; Schinckel,Allan Paul; Garbossa,Cesar Augusto Pospissil; Cantarelli,Vinícius de Souza.
ABSTRACT The intestinal gene expression of RelA/p65 (NF-κB), insulin growth factor 1 (IGF-1), glucose transporter 2 (GLUT2), and Na+/dependent glucose transporter 1 (SGLT1) were evaluated in response to benzoic acid, yeast culture, L-glutamine, and oregano essential oil, using an ex vivo model. Six piglets weighing approximately 20 kg each were sacrificed, and their jejunum was collected and segmented into five 2-cm explants. Each explant was immersed in cell culture medium according to one of the following treatments: control (without additive), 0.5% benzoic acid, 1% yeast culture, 1% L-glutamine, and 0.015% oregano oil. Gene expression was evaluated using RT-PCR. Yeast culture up-regulated the gene expression of RelA/p65, IGF-1, GLUT2, and SGLT1 in...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Chemosensors; Glucose; Piglet; RT-PCR; Swine; Trophic effects.
Ano: 2018 URL: http://www.scielo.br/scielo.php?script=sci_arttext&pid=S1516-35982018000100414
Imagem não selecionada

Imprime registro no formato completo
Efecto del virus del síndrome reproductivo y respiratorio porcino (PRRS) en células dendríticas de cerdo derivadas de monocitos Veterinaria México
Flores-Mendoza,Lilian; Silva-Campa,Erika; Reséndiz,Mónica; Mata-Haro,Verónica; Osorio,Fernando A.; Hernández,Jesús.
Las células dendríticas (DC) son las presentadoras de antígeno más importantes del sistema inmune. Su localización anatómica (piel, mucosas y sangre periférica), la expresión de receptores para reconocer patógenos, la expresión de moléculas de coestimulación (CD80/86), del complejo principal de histocompatibilidad (MHC) clases I y II, y la producción de citocinas (IFN-α, IL-10, IL-12), les confiere una característica única para regular las respuestas inmune innata y adaptativa. El objetivo de este trabajo fue evaluar el efecto del virus de síndrome reproductivo y respiratorio porcino (PRRS) en DC maduras. Se generaron células dendríticas a partir de monocitos utilizando IL-4 y GM-CSF y se estimularon con lipopolisacárido (LPS) para inducir su maduración....
Tipo: Info:eu-repo/semantics/article Palavras-chave: Células dendríticas; Cerdo; CD80; CD86; MHC-II; RT-PCR.
Ano: 2009 URL: http://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S0301-50922009000100005
Imagem não selecionada

Imprime registro no formato completo
Secuenciación de un fragmento de ADNc homólogo a interleucina-1 alfa humana derivado de leucocitos de armadillo (Dasypus novemcinctus) Veterinaria México
Flores-Medina,Saúl; Díaz-García,Francisco J.; Guerra-Infante,Fernando M..
Se realizó detección del ARN mensajero (ARNm) mediante un ensayo de transcripción reversa acoplada a la reacción en cadena de la polimerasa (RT-PCR) específico para la detección de Interleucina-1 alfa humana en leucocitos de armadillo estimulados con acetato de forbol miristato (PMA, por su siglas en inglés); esta estrategia permitió amplificar un fragmento de ADN de 491 pares de bases. Adicionalmente, la secuencia mostró alta homología nucleotídica con las secuencias de ADNc humano (99%), mono (93%), cerdo (82%), caballo (81%) y llama (81%), mientras que la secuencia deducida de aminoácidos fue compatible con el precursor de la proteína IL-1a humana. Estos resultados sugieren presencia del gen de interleucina-1 en el genoma del armadillo; sin embargo, es...
Tipo: Info:eu-repo/semantics/report Palavras-chave: Dasypus novemcinctus; Interleucina-1; RT-PCR; Secuenciación.
Ano: 2008 URL: http://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S0301-50922008000300008
Imagem não selecionada

Imprime registro no formato completo
Occurrence of congenital in Theileria equi Lusitano pure blood foals, diagnosed by RT-PCR MV&Z
Roncati, Neimar V.; Baccarin, Raquel Yvonne Arantes; Massoco, Cristina de Oliveira; Fernandes, Wilson Roberto.
In order to determine the occurrence of transplacentary transmission of Theileria equi in equine neonates, 50 foals of the Lusitano breed, both colts and fillies, along with their respective mothers were evaluated shortly after parturition. Total blood samples were collected from the mothers and the neonates within the first five hours after parturition for the detection of Theileria equi, through use of the RT-PCR technique. The detection kit based on the intercalating dye of DNA SYBERgreen was used. A total of 46% of the mares presented a positive result for Theileria equi and 54% presented negative ones, while 66% of the foals presented positive results, seeing as 73.9% of them were born from also positive mothers. The remaining 34% of foals presented...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Theileria equi; Babesia equi; Babesiosis; RT-PCR; Transplacentary transmission; Congenital Theileria equi; Bacteria equi; Babesiose; RT-PCR; Transmissão transplacentária; Congênita.
Ano: 2011 URL: http://www.revistamvez-crmvsp.com.br/index.php/recmvz/article/view/386
Imagem não selecionada

Imprime registro no formato completo
Canine distemper diagnosis by RT-PCR in dog samples from São Paulo State submitted to rabies laboratory diagnosis MV&Z
Macedo, Carla Isabel; Peixoto, Zélia Maria Pinheiro; Castilho, Juliana Galera; Oliveira, Rafael de Novaes; Rodrigues, Adriana Cândido; Achkar, Samira Maria.
Canine distemper (CD) is one of the most important infectious diseases in domestic dogs. In Brazil, CD is still the principal cause of mortality of dogs in some urban populations. Although different viral gene sequences have been identified for detecting the canine distemper virus (CDV), the N gene appears to be a better target for the amplification of specific fragments from all CDV strains. Using RT-PCR targeted to the CDV N gene, during the year 2014 we analyzed 190 central nervous system (CNS) samples of dogs from the state of São Paulo, Brazil, with symptoms suggestive of encephalitis and sent them to the Pasteur Institute for the diagnosis of rabies. Positivity for CD was over 50%, indicating that the disease remains an important cause of canine...
Tipo: Info:eu-repo/semantics/article Palavras-chave: Canine Distemper; RT-PCR; Encephalitis; Diagnosis cinomose canina; RT-PCR; Encefalite; Diagnóstico.
Ano: 2016 URL: http://www.revistamvez-crmvsp.com.br/index.php/recmvz/article/view/31032
Imagem não selecionada

Imprime registro no formato completo
Detección y caracterización molecular del Virus X de la Papa (PVX) en regiones productoras de papa de Colombia Rev. Protección Veg.
Gil Ramírez,J.F; Cotes Torres,J.M; Marín Montoya,M.
El cultivo de papa (Solanum tuberosum L.) se ve afectado por diferentes virus que reducen su rendimiento y la calidad del tubérculo-semilla. Determinar la distribución y la variabilidad genética de dichos patógenos, es fundamental para los programas de manejo integrado y mejoramiento genético. En este trabajo se evaluó la presencia y la variabilidad molecular de aislados de PVX en cultivos de papa de los departamentos de Antioquia, Cundinamarca, Boyacá y Nariño (Colombia). La evaluación de presencia se realizó mediante pruebas de ELISA, mientras que el análisis de variabilidad incluyó la secuenciación de una región parcial de la cápsida viral en 14 aislamientos y de porciones de los genes codificantes para las proteínas RdRp y Tgb1 para dos aislamientos....
Tipo: Journal article Palavras-chave: Alphaflexiviridae; ELISA; RT-PCR; Solanum tuberosum; Variabilidad genética.
Ano: 2012 URL: http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S1010-27522012000200001
Imagem não selecionada

Imprime registro no formato completo
Detección de potyvirus en plantas de pimiento (Capsicum annuum L.) y áfidos asociados al cultivo en Cuba Rev. Protección Veg.
Arana Labrada,Franklyn; Martínez Rivero,María A; Piñol Pérez,Bertha; Duarte Martínez,Leticia; Pacheco Sánchez,Ronal; Quiñones Pantoja,Madelaine.
El objetivo del trabajo fue detectar, mediante RT-PCR con cebadores genéricos, la presencia de potyvirus en plantas de pimiento (Capsicum annuum L.) con síntomas de moteado y en áfidos asociados al cultivo en los principales polos productivos de las regiones oriental, central y occidental de Cuba. Se extrajo el ARN total y se sintetizó el ADNc de las muestras colectadas. Se identificaron los áfidos como Myzus persicae (Sulzer). Se logró la detección de potyvirus en las muestras de las tres regiones, lo que demuestra que los potyvirus están ampliamente distribuidos en las áreas de producción del cultivo del pimiento en el país.
Tipo: Journal article Palavras-chave: Myzus persicae; Pimiento; Potyvirus; RT-PCR.
Ano: 2015 URL: http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S1010-27522015000300009
Imagem não selecionada

Imprime registro no formato completo
EVALUACIÓN DE LOS PARÁMETROS ANALÍTICOS PARA LA DETECCIÓN MOLECULAR DE POTYVIRUS QUE AFECTAN AL CULTIVO DEL PIMIENTO EN CUBA Rev. Protección Veg.
Díaz,Acela; Quiñones,Madelaine; Hernández,Annia; del Barrio,Gloria.
El género Capsicum (Solanaceae), es originario del continente americano y comprende alrededor de 25 especies, de las cuales cinco son cultivables. Las condiciones ambientales en que se desarrolla esta hortaliza, su forma de explotación, así como los tipos y variedades utilizadas, han traído consigo una amplia diversidad en cuanto a plagas y epifitias que causan importantes mermas en su producción. Entre ellas, las enfermedades virales constituyen la principal dificultad para el desarrollo del cultivo y de estas, las causadas por los miembros del género Potyvirus, se consideran entre las de mayor importancia económica. Este trabajo tiene como objetivo validar un ensayo de RT-PCR para el diagnóstico molecular de potyvirus, empleando cebadores genéricos. Los...
Tipo: Journal article Palavras-chave: Potyvirus; Pimiento; Diagnóstico; RT-PCR.
Ano: 2010 URL: http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S1010-27522010000200002
Imagem não selecionada

Imprime registro no formato completo
COMPARACIÓN DEL LÍMITE DE DETECCIÓN DE MÉTODOS DE ANÁLISIS DE ÁCIDOS NUCLEICOS PARA EL VIROIDE DEL ENANISMO DEL LÚPULO (HSVd) EN CÍTRICOS Rev. Protección Veg.
Soto,Marianela; González,Lien; Peralta,Esther Lilia; Duran-Vila,Nuria.
Se determinó y comparó el límite de detección de la electroforesis secuencial en geles de poliacrilamida (sPAGE), hibridación de ácidos nucleicos (NASH) y transcripción reversa-reacción en cadena de la polimerasa (RT-PCR) para el diagnóstico del viroide del enanismo del lúpulo (HSVd) en cítricos, basados en el análisis de ácidos nucleicos de plantas de cidro y pepino como amplificadores biológicos. El límite de detección de la sPAGE fue mayor (5x10-3) en plantas de pepino que en plantas de cidro (5x10-2); sin embargo, este fue 50 veces menos sensible que el de la NASH (10-4). El límite de detección de la RT-PCR en pepino fue el mayor de todos los métodos analizados (10-6). Dicho valor se potenció cuando los productos de RT-PCR fueron detectados por NASH en...
Tipo: Journal article Palavras-chave: Viroide; HSVd; SPAGE; NASH; RT-PCR; Diagnóstico molecular.
Ano: 2007 URL: http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S1010-27522007000200005
Registros recuperados: 100
Primeira ... 12345 ... Última
 

Empresa Brasileira de Pesquisa Agropecuária - Embrapa
Todos os direitos reservados, conforme Lei n° 9.610
Política de Privacidade
Área restrita

Embrapa
Parque Estação Biológica - PqEB s/n°
Brasília, DF - Brasil - CEP 70770-901
Fone: (61) 3448-4433 - Fax: (61) 3448-4890 / 3448-4891 SAC: https://www.embrapa.br/fale-conosco

Valid HTML 4.01 Transitional